Python 3 please The GFF3 format is a commonly-used one in bioinformatics for representing…

Python 3 please The GFF3 format is a commonly-used one in bioinformatics for representing sequence annotation. You can find the specification here: http://www.sequenceontology.org/g 3.shtml I’ve placed the genome and annotation for Saccharomyces cerevisiae S288C on the class server here: /home/jorvis1/Saccharomyces_cerevisiae_S288C.annotation.gff Note that this same file has both the annotation feature table and the FASTA sequence for the molecules referenced. (See the ‘##FASTA’ directive in the specification.) Within the feature table another column of note is the 9th, where we can
Python 3 please The GFF3 format is a commonly-used one in bioinformatics for representing sequence annotation. You can find the specification here: http://www.sequenceontology.org/g 3.shtml I’ve placed the genome and annotation for Saccharomyces cerevisiae S288C on the class server here: /home/jorvis1/Saccharomyces_cerevisiae_S288C.annotation.gff Note that this same file has both the annotation feature table and the FASTA sequence for the molecules referenced. (See the ‘##FASTA’ directive in the specification.) Within the feature table another column of note is the 9th, where we can store any key=value pairs relevant to that row’s feature such as ID, Ontology_term or Note. Your task is to write a GFF3 feature exporter. A user should be able to run your script like this: $ export_gff3_feature.py –source_gff=/path/to/some.gff3 –type=gene –attribute=ID –value=YAR003W There are 4 arguments here that correspond to values in the GFF3 columns. In this case, your script should read the path to a GFF3 file, find any gene (column 3) which has an ID=YAR003W (column 9). When it finds this, it should use the coordinates for that feature (columns 4, 5 and 7) and the FASTA sequence at the end of the document to return its FASTA sequence. Your script should work regardless of the parameter values passed, warning the user if no features were found that matched their query. (It should also check and warn if more than one feature matches the query.) The output should just be printed on STDOUT (no writing to a file is necessary.) It should have a header which matches their query, like this: >gene:ID:YAR003W …. sequence here … Some bonus points will be awarded if you format the sequence portion of the FASTA output as 60-characters per line, which follows the standard. QUESTION 6 : Write a program that will open a BLASTN (nucleotide to nucleotide search) output file, parse out specific information, and produce formatted output that will be written to STDOUT (i.e. Standard Output; the terminal window / command line). Before writing your program, copy the BLASTP output file, /home/jorvis1/example_blast.txtto your home directory. Look through the file and explore the format. Your program should start by opening the input file (you may hardcode the filename in this case), parsing and storing both the query sequence ID (from near the top of the file; look for the string following “Query=“) and the query length (found on the line below the query sequence), and displaying them both to STDOUT. Add some additional characters and formatting to your output such that these two fields appear exactly like this in STDOUT: Query ID: IREALLYLIKEPYTHON Query Length: 15 Then, it is time to parse information about the significant alignments for this query. Each alignment begins with the “>” symbol. For just the first ten hits, parse out only the accession (located between the first set of pipe symbols, | | ), length and score. For each of these hits, these three fieldsshould then be written to STDOUT in exactly this format including capitalization, spacing, and punctuation (as shown here using the real values for the first hit; study the file to understand exactly where these values came from): Alignment #1: Accession = ref|XM_005094338.1| (Length = 2377, Score = 1098) You must use regular expressions to pull out precisely the parts of the file that you want, which is the definition of parsing. Hint: you will very likely need to use parentheses to put some parts of those expressions into temporary memory (m.group(1), etc.) for later use. Do not have your regular expression search for hardcoded values; your program should be able to read another BLASTN output file and run successfully, not just this specific one. Pay careful attention to the exact appearance of the sample output, above. Although it is a good start to be able to, at a minimum, report the requested val BLASTN 2.2.28+
Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and
Webb Miller (2000), “A greedy algorithm for aligning DNA
sequences”, J Comput Biol 2000; 7(1-2):203-14.
Reference for database indexing: Aleksandr Morgulis, George
Coulouris, Yan Raytselis, Thomas L. Madden, Richa Agarwala,
Alejandro A. Schaffer (2008), “Database Indexing for
Production MegaBLAST Searches”, Bioinformatics 24:1757-1764.
RID: 05EN72CN01R
Database: Nucleotide collection (nt)
19,024,455 sequences; 48,173,360,552 total letters
Query= Arf1
Length=614
Score
Sequences producing significant alignments: E
(Bits) Value ref|XM_005094338.1| PREDICTED: Aplysia californica uncharacte… 1098
0.0
gb|EU829582.1| Linum usitatissimum clone LU0017G02 mRNA sequence
375 2e-100
ref|XM_005023737.1| PREDICTED: Anas platyrhynchos ADP-ribosyl… 372
2e-99
ref|XM_004088641.1| PREDICTED: Nomascus leucogenys ADP-ribosy… 364
4e-97
ref|XM_004088640.1| PREDICTED: Nomascus leucogenys ADP-ribosy… 364
4e-97
ref|XM_004088639.1| PREDICTED: Nomascus leucogenys ADP-ribosy… 364
4e-97
ref|XM_003252207.1| PREDICTED: Nomascus leucogenys ADP-ribosy… 364
4e-97
gb|EU829048.1| Linum usitatissimum clone LU0031C12 mRNA sequence
364 4e-97
ref|NM_001133245.1| Pongo abelii ADP-ribosylation factor 3 (A… 364 4e97
ref|XM_003939112.1| PREDICTED: Saimiri boliviensis boliviensi… 359 2e95
ref|XM_003939111.1| PREDICTED: Saimiri boliviensis boliviensi… 359 2e95
ref|XM_003939110.1| PREDICTED: Saimiri boliviensis boliviensi… 359 2e95
ref|XM_003906306.1| PREDICTED: Papio anubis ADP-ribosylation … 359 2e-95
ref|XM_003906305.1| PREDICTED: Papio anubis ADP-ribosylation … 359
2e-95
ref|XM_001104802.2| PREDICTED: Macaca mulatta ADP-ribosylatio… 359
2e-95
dbj|AB220383.1| Macaca fascicularis mRNA, clone QbsB-11372: s… 359
2e-95
ref|XM_004446938.1| PREDICTED: Dasypus novemcinctus ADP-ribos… 348
4e-92
ref|NM_001015571.2| Bos taurus ADP-ribosylation factor 3 (ARF… 348 4e92
gb|BT020934.1| Bos taurus ADP-ribosylation factor 3 (ARF3), m… 348 4e92
ref|XM_005040511.1| PREDICTED: Ficedula albicollis ADP-ribosy… 344 5e91
ref|XM_004692792.1| PREDICTED: Condylura cristata ADP-ribosyl… 344
5e-91
ref|XM_002194789.2| PREDICTED: Taeniopygia guttata ADP-ribosy… 344
5e-91
ref|XM_004599350.1| PREDICTED: Ochotona princeps ADP-ribosyla… 342
2e-90
ref|XM_002711065.1| PREDICTED: Oryctolagus cuniculus ADP-ribo… 337
9e-89
ref|NM_001162545.1| Ovis aries ADP-ribosylation factor 3 (ARF… 337 9e89
ref|NM_001126681.1| Xenopus (Silurana) tropicalis ADP-ribosyl… 337 9e89
ref|XM_004274380.1| PREDICTED: Orcinus orca ADP-ribosylation … 331
4e-87
ref|XM_004313118.1| PREDICTED: Tursiops truncatus ADP-ribosyl… 326
2e-85
ref|XM_001504136.2| PREDICTED: Equus caballus ADP-ribosylatio… 326
2e-85
ref|XM_002752401.2| PREDICTED: Callithrix jacchus ADP-ribosyl… 316 1e82
ref|XM_003535988.1| PREDICTED: Glycine max ADP-ribosylation f… 309
2e-80
dbj|AK286924.1| Glycine max cDNA, clone: GMFL01-40-F14
309 2e80
dbj|AK286518.1| Glycine max cDNA, clone: GMFL01-30-F14
309 2e80
ref|XM_004586336.1| PREDICTED: Ochotona princeps ADP-ribosyla… 305
2e-79
ref|NM_001173559.1| Salmo salar ADP-ribosylation factor 1 lik… 303 9e79
gb|BT043627.1| Salmo salar clone HM5_0244 ADP-ribosylation fa… 303
9e-79
ref|XM_003555742.1| PREDICTED: Glycine max ADP-ribosylation f… 298
4e-77
ref|XM_003555741.1| PREDICTED: Glycine max ADP-ribosylation f… 298 4e-77
dbj|AK286615.1| Glycine max cDNA, clone: GMFL01-32-K15
298 4e77
gb|BT057759.1| Salmo salar clone ssal-rgb-527-288 ADP-ribosyl… 294 5e76
ref|NM_001012248.2| Danio rerio ADP-ribosylation factor 3b (a… 292 2e75
gb|BC163292.1| Danio rerio ADP-ribosylation factor 3b, mRNA (… 292 2e75
tpg|BK007271.1| TPA: Amblyomma variegatum ADP ribosylation fa… 287
9e-74
dbj|AK287022.1| Glycine max cDNA, clone: GMFL01-42-E24
287 9e74
ref|XM_003216952.1| PREDICTED: Anolis carolinensis ADP-ribosy… 281
4e-72
ref|XM_002431325.1| Pediculus humanus corporis ADP-ribosylati… 281
4e-72
ref|XM_005040510.1| PREDICTED: Ficedula albicollis ADP-ribosy… 278 5e71
ref|XM_003980625.1| PREDICTED: Felis catus ADP-ribosylation f… 278 5e71
ref|XM_005061367.1| PREDICTED: Ficedula albicollis ADP-ribosy… 263 1e66
ref|XM_003961069.1| PREDICTED: Takifugu rubripes ADP-ribosyla… 243
2e-60
ref|XM_004891797.1| PREDICTED: Heterocephalus glaber uncharac… 241
7e-60
ref|XM_002130518.2| PREDICTED: Ciona intestinalis ADP-ribosyl… 237 9e59
ref|XM_004891798.1| PREDICTED: Heterocephalus glaber uncharac… 230
1e-56
gb|GQ279375.1| Marsupenaeus japonicus ADP ribosylation factor… 226
2e-55
ref|XM_001899177.1| Brugia malayi ADP-ribosylation factor 4 p… 213 1e51
ref|NM_001272158.1| Drosophila melanogaster ADP ribosylation … 202
3e-48
ref|NM_079892.3| Drosophila melanogaster ADP ribosylation fac… 202 3e48
gb|FJ637149.1| Synthetic construct Drosophila melanogaster cl… 202 3e48
gb|FJ632736.1| Synthetic construct Drosophila melanogaster cl… 202 3e48
gb|AY071450.1| Drosophila melanogaster RE53354 full length cDNA
202
3e-48
ref|XM_005061366.1| PREDICTED: Ficedula albicollis ADP-ribosy… 185 3e43
gb|BT082428.1| Anoplopoma fimbria clone afim-evh-507-178 ADP-… 182
4e-42
ref|XM_002099605.1| Drosophila yakuba Arf102F (DyakArf102F),… 174 7e-40
ref|XM_001982651.1| Drosophila erecta GG16407 (DereGG16407),… 174
7e-40
gb|AY231946.1| Drosophila yakuba clone yak-em_Arf102F mRNA se… 174
7e-40
gb|AE014135.3| Drosophila melanogaster chromosome 4, complete… 159
2e-35
gb|AC010577.5| Drosophila melanogaster clone BACR22J20, compl… 159
2e-35
gb|L25062.1|DROARF2A Drosophila melanogaster ADP-ribosylation… 159
2e-35
ref|XM_004891799.1| PREDICTED: Heterocephalus glaber uncharac… 158
7e-35
emb|CR450743.3| Zebrafish DNA sequence from clone CH211-157H1… 115
4e-22
gb|AC166090.23| Glycine max clone gmw1-103e11, complete sequence
115 4e-22
emb|AL953886.9| Zebrafish DNA sequence from clone CH211-241A1… 115
4e-22
emb|AL591389.5| Zebrafish DNA sequence from clone BUSM1-202L1… 115
4e-22
gb|GQ483536.1| Marsupenaeus japonicus ADP-ribosylation factor… 99.0
4e-17
ref|XM_790917.3| PREDICTED: Strongylocentrotus purpuratus E3 … 84.2
1e-12
ref|XM_001819859.2| Aspergillus oryzae RIB40 ADP-ribosylation… 78.7 6e11
ref|XM_002374515.1| Aspergillus flavus NRRL3357 ADP-ribosylat… 78.7
6e-11
ref|XM_001186642.2| PREDICTED: Strongylocentrotus purpuratus … 76.8
2e-10
ref|XM_001399874.2| Aspergillus niger CBS 513.88 ADP-ribosyla… 76.8 2e10
dbj|AB224387.1| Aspergillus oryzae cDNA, contig sequence: AoE… 76.8
2e-10
ALIGNMENTS
>ref|XM_005094338.1| PREDICTED: Aplysia californica uncharacterized
LOC101860729 (LOC101860729),
mRNA
Length=2377
Score = 1098 bits (594), Expect = 0.0
Identities = 594/594 (100%), Gaps = 0/594 (0%)
Strand=Plus/Plus
Query 21
AACTGATCAAAATGGGGAACATGTTTGCTTCGCTGTTCAAGGGCCTCTTTGGGAGGT
CCG 80
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 593
AACTGATCAAAATGGGGAACATGTTTGCTTCGCTGTTCAAGGGCCTCTTTGGGAGGT
CCG 652
Query 81
AAATGAGAATTTTGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAA
GT 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 653
AAATGAGAATTTTGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAA
GT 712
Query 141
TGAAACTGGGTGAAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAG
TGG 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 713
TGAAACTGGGTGAAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAG
TGG 772
Query 201
AGTACAAGAACATCAGCTTCACAGTGTGGGATGTTGGTGGCCAAGACAAAATTCGAC
CCC 260
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 773
AGTACAAGAACATCAGCTTCACAGTGTGGGATGTTGGTGGCCAAGACAAAATTCGAC
CCC 832
Query 261
TTTGGAGGCATTATTTTCAGAACACACAAGGACTCATTTTTGTGATAGACAGTAATGAC
A 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 833
TTTGGAGGCATTATTTTCAGAACACACAAGGACTCATTTTTGTGATAGACAGTAATGAC
A 892
Query 321
GAGAAAGAGTTGGTGAAGCAAGAGAAGAATTGATGAGGATGCTGAATGAAGATGAA
CTGA 380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 893
GAGAAAGAGTTGGTGAAGCAAGAGAAGAATTGATGAGGATGCTGAATGAAGATGAA
CTGA 952
Query 381
GAGATGCCATCCTCCTTGTGTTTGCGAACAAACAGGATCTGCCAAATGCTATGAATGC
TG 440
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 953
GAGATGCCATCCTCCTTGTGTTTGCGAACAAACAGGATCTGCCAAATGCTATGAATGC TG 1012
Query 441
CAGAAATCACAGACAAGCTTGGCCTGCACTCACTTCGTAGTCGTCAATGGTTTATCCA
GG 500
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1013
CAGAAATCACAGACAAGCTTGGCCTGCACTCACTTCGTAGTCGTCAATGGTTTATCCA
GG 1072
Query 501
CTACATGTGCCACAAGTGGAGACGGCTTATATGAAGGACTGGATTGGCTGTCCAATA
CTC 560
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1073
CTACATGTGCCACAAGTGGAGACGGCTTATATGAAGGACTGGATTGGCTGTCCAATA
CTC 1132
Query 561
TAAAAAAGAAATCCTCATAATGAGTGGTTCTAGAGGCTTTTCTTTTTATTTTCC 614
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1133
TAAAAAAGAAATCCTCATAATGAGTGGTTCTAGAGGCTTTTCTTTTTATTTTCC 1186
>gb|EU829582.1| Linum usitatissimum clone LU0017G02 mRNA sequence
Length=858
Score = 375 bits (203), Expect = 2e-100
Identities = 386/476 (81%), Gaps = 6/476 (1%)
Strand=Plus/Plus
Query 83
ATGAGAATTTTGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAAGT
TG 142
||||||||| ||||||||||| | ||||| ||||| |||||||| |||||||||||| ||
Sbjct 166
ATGAGAATTCTGATGGTTGGTCTCGATGCGGCTGGTAAGACCACCATCTTGTACAAGC
TG 225
Query 143
AAACTGGGTGAAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAGTG
GAG 202
||||| ||||| || ||||| || || || || ||||| |||||||| ||||| |||||
Sbjct 226
AAACTTGGTGAGATCGTCACCACCATTCCTACCATTGGATTCAATGTGGAGACTGTGG
AA 285
Query 203
TACAAGAACATCAGCTTCACAGTGTGGGATGTTGGTGGCCAAGACAAAATTCGACCC CTT 262
|||||||||||||||||||||||||||||||| || || |||||||| || ||||| |
Sbjct 286
TACAAGAACATCAGCTTCACAGTGTGGGATGTCGGGGGTCAAGACAAGATCCGACCA
TTG 345
Query 263
TGGAGGCATTATTTTCAGAACACACAAGGACTCATTTTTGTGATAGACAGTAATGACA
GA 322
|||||||| ||||| || ||||| || || ||||| ||||| | |||||||||||||||
Sbjct 346
TGGAGGCACTATTTCCAAAACACTCAGGGTCTCATCTTTGTTGTGGACAGTAATGACA
GA 405
Query 323 GAAAGAGTTGGTGAAGCAAGAGAAGAATTGATGAGGATGCTGAATGAAGATGAACTGAG 381
|| | |||| ||| || ||||| |||||| || |||||| |||| || |||||||| |
Sbjct 406 GATCGTGTTGTTGAGGCCAGAGATGAATTGCATAGGATGTTGAACGAGGATGAACTCCG 464
Query 382
AGATGCCATCCTCCTTGTGTTTGCGAACAAACAGGATCTGCCAAATGCTATGAATGCT
GC 441
|||||| | | || || || || ||||||||||||||||||||||| |||||||| ||
Sbjct 465
AGATGCAGTGTTGCTCGTTTTCGCTAACAAACAGGATCTGCCAAATGCAATGAATGCC
GC 524
Query 442
AGAAATCACAGACAAGCTTGGCCTGCACTCACTTCGTAGTCGTCAATGGTTTATCCAGG 500
|| ||||| |||||||| ||||| |||||||| || || || |||| |||||| |
Sbjct 525
TGAGATCACTGACAAGCTCGGCCTCCACTCACTCCGCCAACGACACTGGTACATCCA
GAG 584
Query 501 CTACATGTGCCACAAGTGGAGACGGCTTATATGAAGGACTGGATTGGCTGTCCAA 555
| || ||||| ||| || || || ||| || ||||| ||||||||||| |||||
Sbjct 585 C-ACCTGTGCTACATCAGGTGAGGGTCTTTACGAAGGCCTGGATTGGCTCTCCAA 638
>ref|XM_005023737.1| PREDICTED: Anas platyrhynchos ADP-ribosylation
factor 1 (ARF1),
mRNA
Length=1939
Score = 372 bits (201), Expect = 2e-99
Identities = 401/501 (80%), Gaps = 0/501 (0%) Strand=Plus/Plus
Query 56
TTCAAGGGCCTCTTTGGGAGGTCCGAAATGAGAATTTTGATGGTTGGTTTGGATGCT
GCT 115
||||| ||||||||||| |
|||||| | || | ||||||||| ||||||||||
Sbjct 59
TTCAAAGGCCTCTTTGGCAAAAAAGAAATGCGGATCCTCATGGTTGGTCTGGATGCT
GCA 118
Query 116
GGAAAGACCACAATCTTGTACAAGTTGAAACTGGGTGAAATTGTCACAACGATCCCA
ACA 175
|||||||| || ||||||||||| ||||||| |||||||| || || || ||||| ||
Sbjct 119
GGAAAGACTACTATCTTGTACAAACTGAAACTTGGTGAAATAGTAACTACTATCCCTAC
T 178
Query 176
ATTGGGTTCAATGTAGAGACAGTGGAGTACAAGAACATCAGCTTCACAGTGTGGGAT
GTT 235
|| || |||||||| || || || || ||||||||||||||||||||||||||||||||
Sbjct 179
ATAGGTTTCAATGTGGAAACGGTAGAATACAAGAACATCAGCTTCACAGTGTGGGATG
TC 238
Query 236
GGTGGCCAAGACAAAATTCGACCCCTTTGGAGGCATTATTTTCAGAACACACAAGGA
CTC 295
|| ||||| || || || |||| || ||| | |||||||| |||||||||||||| ||
Sbjct 239
GGCGGCCAGGATAAGATCAGACCGCTCTGGCGCCATTATTTCCAGAACACACAAGGT
CTG 298
Query 296
ATTTTTGTGATAGACAGTAATGACAGAGAAAGAGTTGGTGAAGCAAGAGAAGAATTG
ATG 355
||||||||| | ||||| |||||||||||| |||| || || |||||||| | |||
Sbjct 299
ATTTTTGTGGTTGACAGCAATGACAGAGAACGAGTGAACGAGGCCAGAGAAGAGCT
CATG 358
Query 356
AGGATGCTGAATGAAGATGAACTGAGAGATGCCATCCTCCTTGTGTTTGCGAACAAA
CAG 415
|| ||| || |||||||| || ||||||||| | | | |||||||| |||||||||
Sbjct 359
AGAATGTTGGCAGAAGATGAGCTTAGAGATGCCGTTTTATTAGTGTTTGCTAACAAAC
AG 418 Query 416
GATCTGCCAAATGCTATGAATGCTGCAGAAATCACAGACAAGCTTGGCCTGCACTCA
CTT 475
|| ||||| || || |||||||| ||||||||||||||||| ||||| ||||| || |||
Sbjct 419
GACCTGCCCAACGCGATGAATGCAGCAGAAATCACAGACAAACTTGGACTGCATTCT
CTT 478
Query 476
CGTAGTCGTCAATGGTTTATCCAGGCTACATGTGCCACAAGTGGAGACGGCTTATATG
AA 535
||| | | |||| |||||||| || |||||||| || |||||||| | ||||||
Sbjct 479
CGTCACAGGAACTGGTACATCCAGGCAACCTGTGCCACTAGCGGAGACGGTCTCTAT
GAA 538
Query 536 GGACTGGATTGGCTGTCCAAT 556
|||||||| ||| ||||||||
Sbjct 539 GGACTGGACTGGTTGTCCAAT 559
>ref|XM_004088641.1| PREDICTED: Nomascus leucogenys ADP-ribosylation
factor 3 (ARF3),
mRNA
Length=3923
Score = 364 bits (197), Expect = 4e-97
Identities = 387/481 (80%), Gaps = 3/481 (1%)
Strand=Plus/Plus
Query 93
TGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAAGTTGAAACTGG
GTG 152
||||||| || ||||||| || ||||||||||| ||| | |||||| |||||||||| |
Sbjct 194
TGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTG
GGGG 253
Query 153
AAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAGTGGAGTACAAGAA
CA 212
| || ||||| || ||||| || |||||||||||||| |||||||||||||| |||||||
Sbjct 254
AGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAA
CA 313
Query 213
TCAGCTTCACAGTGTGGGATGTTGGTGGCCAAGACAAAATTCGACCCCTTTGGAGGC
ATT 272
|||||||||||||||||||||| |||||||| ||||| ||||||||||| ||||| || | Sbjct 314
TCAGCTTCACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGA
CACT 373
Query 273
ATTTTCAGAACACACAAGGACTCATTTTTGTGATAGACAGTAATGACAGAGAAAGAGT
TG 332
| || |||||||| ||||| | || |||||| | ||||| ||||| | || ||||
Sbjct 374
ACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAG
TAA 433
Query 333
GTGAAGCAAGAGAAGAATTGATGAGGATGCTGAATGAAGATGAACTGAGAGATGCC
ATCC 392
||| || | ||||| ||||||| |||||| || || || || | ||||| | |
Sbjct 434
ATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGC
TGTAC 493
Query 393
TCCTTGTGTTTGCGAACAAACAGGATCTGCCAAATGCTATGAATGCTGCAGAAATCAC
AG 452
||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || |||||||
Sbjct 494
TCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCAC
AG 553
Query 453
ACAAGCTTGGCCTGCACTCACTTCGTAGTCGTCAATGGTTTATCCAGGCTACATGTGC
CA 512
||||||| |||||||| || |||||| ||| | |||| || ||||| || |||||||
Sbjct 554
ACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTG
CCA 613
Query 513 CAAGTGGAGACGGCTTATATGAAGGACTGGATTGGCTGTCCAAT-ACTCTAAAA-AAGA 569
| || || ||||| | || ||||| ||||| |||||| ||||| | ||| |||| ||||
Sbjct 614
CCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAA
CAAGA 673
Query 570 A 570
|
Sbjct 674 A 674
>ref|XM_004088640.1| PREDICTED: Nomascus leucogenys ADP-ribosylation
factor 3 (ARF3), mRNA
Length=3898
Score = 364 bits (197), Expect = 4e-97
Identities = 387/481 (80%), Gaps = 3/481 (1%)
Strand=Plus/Plus
Query 93
TGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAAGTTGAAACTGG
GTG 152
||||||| || ||||||| || ||||||||||| ||| | |||||| |||||||||| |
Sbjct 169
TGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTG
GGGG 228
Query 153
AAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAGTGGAGTACAAGAA
CA 212
| || ||||| || ||||| || |||||||||||||| |||||||||||||| |||||||
Sbjct 229
AGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAA
CA 288
Query 213
TCAGCTTCACAGTGTGGGATGTTGGTGGCCAAGACAAAATTCGACCCCTTTGGAGGC
ATT 272
|||||||||||||||||||||| |||||||| ||||| ||||||||||| ||||| || |
Sbjct 289
TCAGCTTCACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGA
CACT 348
Query 273
ATTTTCAGAACACACAAGGACTCATTTTTGTGATAGACAGTAATGACAGAGAAAGAGT
TG 332
| || |||||||| ||||| | || |||||| | ||||| ||||| | || ||||
Sbjct 349
ACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAG
TAA 408
Query 333
GTGAAGCAAGAGAAGAATTGATGAGGATGCTGAATGAAGATGAACTGAGAGATGCC
ATCC 392
||| || | ||||| ||||||| |||||| || || || || | ||||| | |
Sbjct 409
ATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGC
TGTAC 468
Query 393
TCCTTGTGTTTGCGAACAAACAGGATCTGCCAAATGCTATGAATGCTGCAGAAATCAC
AG 452 ||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || |||||||
Sbjct 469
TCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCAC
AG 528
Query 453
ACAAGCTTGGCCTGCACTCACTTCGTAGTCGTCAATGGTTTATCCAGGCTACATGTGC
CA 512
||||||| |||||||| || |||||| ||| | |||| || ||||| || |||||||
Sbjct 529
ACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTG
CCA 588
Query 513 CAAGTGGAGACGGCTTATATGAAGGACTGGATTGGCTGTCCAAT-ACTCTAAAA-AAGA 569
| || || ||||| | || ||||| ||||| |||||| ||||| | ||| |||| ||||
Sbjct 589
CCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAA
CAAGA 648
Query 570 A 570
|
Sbjct 649 A 649
>ref|XM_004088639.1| PREDICTED: Nomascus leucogenys ADP-ribosylation
factor 3 (ARF3),
mRNA
Length=4026
Score = 364 bits (197), Expect = 4e-97
Identities = 387/481 (80%), Gaps = 3/481 (1%)
Strand=Plus/Plus
Query 93
TGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAAGTTGAAACTGG
GTG 152
||||||| || ||||||| || ||||||||||| ||| | |||||| |||||||||| |
Sbjct 297
TGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTG
GGGG 356
Query 153
AAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAGTGGAGTACAAGAA
CA 212
| || ||||| || ||||| || |||||||||||||| |||||||||||||| |||||||
Sbjct 357
AGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAA
CA 416 Query 213
TCAGCTTCACAGTGTGGGATGTTGGTGGCCAAGACAAAATTCGACCCCTTTGGAGGC
ATT 272
|||||||||||||||||||||| |||||||| ||||| ||||||||||| ||||| || |
Sbjct 417
TCAGCTTCACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGA
CACT 476
Query 273
ATTTTCAGAACACACAAGGACTCATTTTTGTGATAGACAGTAATGACAGAGAAAGAGT
TG 332
| || |||||||| ||||| | || |||||| | ||||| ||||| | || ||||
Sbjct 477
ACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAG
TAA 536
Query 333
GTGAAGCAAGAGAAGAATTGATGAGGATGCTGAATGAAGATGAACTGAGAGATGCC
ATCC 392
||| || | ||||| ||||||| |||||| || || || || | ||||| | |
Sbjct 537
ATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGC
TGTAC 596
Query 393
TCCTTGTGTTTGCGAACAAACAGGATCTGCCAAATGCTATGAATGCTGCAGAAATCAC
AG 452
||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || |||||||
Sbjct 597
TCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCAC
AG 656
Query 453
ACAAGCTTGGCCTGCACTCACTTCGTAGTCGTCAATGGTTTATCCAGGCTACATGTGC
CA 512
||||||| |||||||| || |||||| ||| | |||| || ||||| || |||||||
Sbjct 657
ACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTG
CCA 716
Query 513 CAAGTGGAGACGGCTTATATGAAGGACTGGATTGGCTGTCCAAT-ACTCTAAAA-AAGA 569
| || || ||||| | || ||||| ||||| |||||| ||||| | ||| |||| ||||
Sbjct 717
CCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAA
CAAGA 776
Query 570 A 570
|
Sbjct 777 A 777 >ref|XM_003252207.1| PREDICTED: Nomascus leucogenys ADP-ribosylation
factor 3 (ARF3),
mRNA
Length=4128
Score = 364 bits (197), Expect = 4e-97
Identities = 387/481 (80%), Gaps = 3/481 (1%)
Strand=Plus/Plus
Query 93
TGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAAGTTGAAACTGG
GTG 152
||||||| || ||||||| || ||||||||||| ||| | |||||| |||||||||| |
Sbjct 399
TGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTG
GGGG 458
Query 153
AAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAGTGGAGTACAAGAA
CA 212
| || ||||| || ||||| || |||||||||||||| |||||||||||||| |||||||
Sbjct 459
AGATCGTCACCACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAGTATAAGAA
CA 518
Query 213
TCAGCTTCACAGTGTGGGATGTTGGTGGCCAAGACAAAATTCGACCCCTTTGGAGGC
ATT 272
|||||||||||||||||||||| |||||||| ||||| ||||||||||| ||||| || |
Sbjct 519
TCAGCTTCACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGA
CACT 578
Query 273
ATTTTCAGAACACACAAGGACTCATTTTTGTGATAGACAGTAATGACAGAGAAAGAGT
TG 332
| || |||||||| ||||| | || |||||| | ||||| ||||| | || ||||
Sbjct 579
ACTTCCAGAACACCCAAGGGTTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAG
TAA 638
Query 333
GTGAAGCAAGAGAAGAATTGATGAGGATGCTGAATGAAGATGAACTGAGAGATGCC
ATCC 392
||| || | ||||| ||||||| |||||| || || || || | ||||| | |
Sbjct 639
ATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGC
TGTAC 698 Query 393
TCCTTGTGTTTGCGAACAAACAGGATCTGCCAAATGCTATGAATGCTGCAGAAATCAC
AG 452
||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || |||||||
Sbjct 699
TCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCAC
AG 758
Query 453
ACAAGCTTGGCCTGCACTCACTTCGTAGTCGTCAATGGTTTATCCAGGCTACATGTGC
CA 512
||||||| |||||||| || |||||| ||| | |||| || ||||| || |||||||
Sbjct 759
ACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTG
CCA 818
Query 513 CAAGTGGAGACGGCTTATATGAAGGACTGGATTGGCTGTCCAAT-ACTCTAAAA-AAGA 569
| || || ||||| | || ||||| ||||| |||||| ||||| | ||| |||| ||||
Sbjct 819
CCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAA
CAAGA 878
Query 570 A 570
|
Sbjct 879 A 879
>gb|EU829048.1| Linum usitatissimum clone LU0031C12 mRNA sequence
Length=750
Score = 364 bits (197), Expect = 4e-97
Identities = 384/476 (81%), Gaps = 6/476 (1%)
Strand=Plus/Plus
Query 83
ATGAGAATTTTGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAAGT
TG 142
||||||||| ||||||||||| | ||||| ||||| |||||||| |||||||||||| ||
Sbjct 166
ATGAGAATTCTGATGGTTGGTCTCGATGCGGCTGGTAAGACCACCATCTTGTACAAGC
TG 225
Query 143
AAACTGGGTGAAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAGTG
GAG 202
||||| ||||| || ||| | || || || || ||||| |||||||| ||||| |||||
Sbjct 226
AAACTTGGTGAGATCGTCTCCACCATTCCTACCATTGGATTCAATGTGGAGACTGTGG AA 285
Query 203
TACAAGAACATCAGCTTCACAGTGTGGGATGTTGGTGGCCAAGACAAAATTCGACCC
CTT 262
|||||||||||||||||||||||||||||||| || || |||||||| || ||||| |
Sbjct 286
TACAAGAACATCAGCTTCACAGTGTGGGATGTCGGGGGTCAAGACAAGATCCGACCA
TTG 345
Query 263
TGGAGGCATTATTTTCAGAACACACAAGGACTCATTTTTGTGATAGACAGTAATGACA
GA 322
|||||||| ||||| || ||||| || || ||||| ||||| | |||||||||||||||
Sbjct 346
TGGAGGCACTATTTCCAAAACACTCAGGGTCTCATCTTTGTTGTGGACAGTAATGACA
GA 405
Query 323 GAAAGAGTTGGTGAAGCAAGAGAAGAATTGATGAGGATGCTGAATGAAGATGAACTGAG 381
|| | |||| ||| || ||||| |||||| || |||||| |||| || |||||||| |
Sbjct 406 GATCGTGTTGTTGAGGCCAGAGATGAATTGCATAGGATGTTGAACGAGGATGAACTCCG 464
Query 382
AGATGCCATCCTCCTTGTGTTTGCGAACAAACAGGATCTGCCAAATGCTATGAATGCT
GC 441
|||||| | | || || || || ||||||||||||||| ||||||| |||||||| ||
Sbjct 465
AGATGCAGTGTTGCTCGTTTTCGCTAACAAACAGGATCTGTCAAATGCAATGAATGCC
GC 524
Query 442
AGAAATCACAGACAAGCTTGGCCTGCACTCACTTCGTAGTCGTCAATGGTTTATCCAGG 500
|| ||||| |||||||| ||||| |||||||| || || || |||| |||||| |
Sbjct 525
TGAGATCACTGACAAGCTCGGCCTCCACTCACTCCGCCAACGACACTGGTACATCCA
GAG 584
Query 501 CTACATGTGCCACAAGTGGAGACGGCTTATATGAAGGACTGGATTGGCTGTCCAA 555
| || ||||| ||| || || || ||| || ||||| ||||||||||| |||||
Sbjct 585 C-ACCTGTGCTACATCAGGTGAGGGTCTTTACGAAGGCCTGGATTGGCTCTCCAA 638
>ref|NM_001133245.1| Pongo abelii ADP-ribosylation factor 3 (ARF3), mRNA
emb|CR860810.1| Pongo abelii mRNA; cDNA DKFZp469P1914 (from clone
DKFZp469P1914) Length=3605
Score = 364 bits (197), Expect = 4e-97
Identities = 387/481 (80%), Gaps = 3/481 (1%)
Strand=Plus/Plus
Query 93
TGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAAGTTGAAACTGG
GTG 152
||||||| || |||||||||| || |||||||| ||| | |||||| |||||||||| |
Sbjct 349
TGATGGTGGGCCTGGATGCTGCAGGGAAGACCACCATCCTATACAAGCTGAAACTG
GGGG 408
Query 153
AAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAGTGGAGTACAAGAA
CA 212
| || ||||| || ||||| || |||||||||||||| ||||||||||| || |||||||
Sbjct 409
AGATCGTCACGACCATCCCTACCATTGGGTTCAATGTGGAGACAGTGGAATATAAGAA
CA 468
Query 213
TCAGCTTCACAGTGTGGGATGTTGGTGGCCAAGACAAAATTCGACCCCTTTGGAGGC
ATT 272
|||||||||||||||||||||| |||||||| ||||| ||||||||||| ||||| || |
Sbjct 469
TCAGCTTCACAGTGTGGGATGTGGGTGGCCAGGACAAGATTCGACCCCTCTGGAGA
CACT 528
Query 273
ATTTTCAGAACACACAAGGACTCATTTTTGTGATAGACAGTAATGACAGAGAAAGAGT
TG 332
| || |||||||| |||||| | || |||||| | ||||| ||||| | || ||||
Sbjct 529
ACTTCCAGAACACCCAAGGATTGATATTTGTGGTCGACAGCAATGATCGGGAGCGAG
TAA 588
Query 333
GTGAAGCAAGAGAAGAATTGATGAGGATGCTGAATGAAGATGAACTGAGAGATGCC
ATCC 392
||| || | ||||| ||||||| |||||| || || || || | ||||| | |
Sbjct 589
ATGAGGCCCGGGAAGAGCTGATGAGAATGCTGGCGGAGGACGAGCTCCGGGATGC
TGTAC 648
Query 393
TCCTTGTGTTTGCGAACAAACAGGATCTGCCAAATGCTATGAATGCTGCAGAAATCAC
AG 452
||||||| ||||| ||||||||||||||||| ||||||||||| ||||| || ||||||| Sbjct 649
TCCTTGTCTTTGCAAACAAACAGGATCTGCCTAATGCTATGAACGCTGCTGAGATCAC
AG 708
Query 453
ACAAGCTTGGCCTGCACTCACTTCGTAGTCGTCAATGGTTTATCCAGGCTACATGTGC
CA 512
||||||| |||||||| || |||||| ||| | |||| || ||||| || |||||||
Sbjct 709
ACAAGCTGGGCCTGCATTCCCTTCGTCACCGTAACTGGTACATTCAGGCCACCTGTG
CCA 768
Query 513 CAAGTGGAGACGGCTTATATGAAGGACTGGATTGGCTGTCCAAT-ACTCTAAAA-AAGA 569
| || || ||||| | || ||||| ||||| |||||| ||||| | ||| |||| ||||
Sbjct 769
CCAGCGGGGACGGGCTGTACGAAGGCCTGGACTGGCTGGCCAATCAGCTCAAAAA
CAAGA 828
Query 570 A 570
|
Sbjct 829 A 829
>ref|XM_003939112.1| PREDICTED: Saimiri boliviensis boliviensis ADPribosylation factor
3, transcript variant 3 (ARF3), mRNA
Length=1417
Score = 359 bits (194), Expect = 2e-95
Identities = 386/481 (80%), Gaps = 3/481 (1%)
Strand=Plus/Plus
Query 93
TGATGGTTGGTTTGGATGCTGCTGGAAAGACCACAATCTTGTACAAGTTGAAACTGG
GTG 152
||||||| || ||||||| || ||||||||||| ||| | |||||| |||||||||| |
Sbjct 169
TGATGGTGGGCCTGGATGCCGCAGGAAAGACCACCATCCTATACAAGCTGAAACTG
GGGG 228
Query 153
AAATTGTCACAACGATCCCAACAATTGGGTTCAATGTAGAGACAGTGGAGTACAAGAA
CA 212
| || ||||| || ||||| || ||||||||||| ||

View less »

Calculate the price of your order

550 words
We'll send you the first draft for approval by September 11, 2018 at 10:52 AM
Total price:
$26
The price is based on these factors:
Academic level
Number of pages
Urgency
Basic features
  • Free title page and bibliography
  • Unlimited revisions
  • Plagiarism-free guarantee
  • Money-back guarantee
  • 24/7 support
On-demand options
  • Writer’s samples
  • Part-by-part delivery
  • Overnight delivery
  • Copies of used sources
  • Expert Proofreading
Paper format
  • 275 words per page
  • 12 pt Arial/Times New Roman
  • Double line spacing
  • Any citation style (APA, MLA, Chicago/Turabian, Harvard)

Our guarantees

Delivering a high-quality product at a reasonable price is not enough anymore.
That’s why we have developed 5 beneficial guarantees that will make your experience with our service enjoyable, easy, and safe.

Money-back guarantee

You have to be 100% sure of the quality of your product to give a money-back guarantee. This describes us perfectly. Make sure that this guarantee is totally transparent.

Read more

Zero-plagiarism guarantee

Each paper is composed from scratch, according to your instructions. It is then checked by our plagiarism-detection software. There is no gap where plagiarism could squeeze in.

Read more

Free-revision policy

Thanks to our free revisions, there is no way for you to be unsatisfied. We will work on your paper until you are completely happy with the result.

Read more

Privacy policy

Your email is safe, as we store it according to international data protection rules. Your bank details are secure, as we use only reliable payment systems.

Read more

Fair-cooperation guarantee

By sending us your money, you buy the service we provide. Check out our terms and conditions if you prefer business talks to be laid out in official language.

Read more